SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcription repressor ([SW|TetR family])
33.16 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
control of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] stability
transcription repressor

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,388,113 3,388,988

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B208 (yuxN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG, downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
  • BKK33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG, downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
  • References

  • 20525796,30001325