SubtiBank SubtiBank
ytmA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytmA

unknown
locus
BSU_30580
pI
9.96
mw
29.53 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,131,446 3,132,219

    The protein

    Protein family

  • peptidase S9B family (single member, according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A302 (ytmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/302 NBRP B. subtilis, Japan]
  • BKE30580 ([gene|1DDE2B06CEE8931A39C8EF3B932D01794FF3AF08|ytmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCCGCCTCCTTTT, downstream forward: _UP4_TGACAGTGAAATATGTTATG
  • BKK30580 ([gene|1DDE2B06CEE8931A39C8EF3B932D01794FF3AF08|ytmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCCGCCTCCTTTT, downstream forward: _UP4_TGACAGTGAAATATGTTATG