SubtiBank SubtiBank
tlpA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

tlpA

membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, acts also as pH sensor, responds to decreasing pH as an attractant signal
locus
BSU_31250
pI
4.91
mw
72.09 kDa
protein length
662 aa Sequence Blast
gene length
1989 bp Sequence Blast
function
control of chemotaxis, sensing of acidic environments
product
methyl-accepting chemotaxis protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,208,280 3,210,268

    The protein

    Paralogous protein(s)

  • [protein|4CD44AD8FE68516C84889EAA2137828E06B8A30B|TlpB], [protein|8333CD46F704F03A22482CAA98DEFCC945362A10|McpC], [protein|E4E1020B799A1B403BDB4847B91B02D64D161AF3|McpB], [protein|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|McpA]
  • [SW|Domains]

  • [SW|Cache domain] (aa 152-228) (according to UniProt)
  • [SW|HAMP domain] (aa 303-355) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 374-610) (according to UniProt)
  • Structure

  • [PDB|6S1K] (from E. coli, corresponds to aa 285 ... 552, 33% identity) [pubmed|31925330]
  • [SW|Localization]

  • cell membrane [Pubmed|21515776], Polar (Septum) [Pubmed|16479537]
  • accumulates at strongly curved membrane areas generated during cell division [Pubmed|26522943]
  • Expression and Regulation

    Operons

    genes
    [gene|1DE26CDEE952142C1303C822F0E2A63AE09F721B|tlpA]-[gene|F02E3080214A327E131ECDE0DBC52C57EFDFE2CE|mcpA]
    description
    [Pubmed|8188684]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|8188684], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • in minimal medium, McpA is present with 15,900 +/- 3,000 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • BKE31250 ([gene|1DE26CDEE952142C1303C822F0E2A63AE09F721B|tlpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTTTGAACCTTCT, downstream forward: _UP4_TAATAGGTCTAAAATACTAT
  • BKK31250 ([gene|1DE26CDEE952142C1303C822F0E2A63AE09F721B|tlpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTTTGAACCTTCT, downstream forward: _UP4_TAATAGGTCTAAAATACTAT
  • References

    Reviews

  • 31792011
  • Original publications

  • 8188684,21515776,16479537,20817675,26522943,31685537,31925330