SubtiBank SubtiBank
ywkB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywkB

unknown
locus
BSU_37040
pI
7.11
mw
33.49 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,799,377 3,800,336

    The protein

    Protein family

  • auxin efflux carrier (TC 2.A.69) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]-[gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]
    description
    [Pubmed|12949160]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12949160], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, [Pubmed|12949160], in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • expressed in the presence of malate ([protein|search|MalR]) [Pubmed|12949160]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B656 (ywkB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1655 NBRP B. subtilis, Japan]
  • BKE37040 ([gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATTCTCCTCCAAAT, downstream forward: _UP4_TAACAAAAAAAGCTCCCTTT
  • BKK37040 ([gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATTCTCCTCCAAAT, downstream forward: _UP4_TAACAAAAAAAGCTCCCTTT
  • References

  • 12949160,21815947