SubtiBank SubtiBank
ywkB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywkB

unknown
locus
BSU_37040
pI
7.11
mw
33.49 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,799,377 3,800,336

    The protein

    Protein family

  • auxin efflux carrier (TC 2.A.69) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|4F30A4412768E6313F57BD56C4EF5079F500E0C4|maeA]-[gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]
    description
    [Pubmed|12949160]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12949160], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR]: activation, [Pubmed|12949160], in [regulon|689CF50691E77E5A40437EF1E6B5083AF7CFCE08|MalR regulon]
  • regulation

  • expressed in the presence of malate ([protein|search|MalR]) [Pubmed|12949160]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B656 (ywkB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1655 NBRP B. subtilis, Japan]
  • BKE37040 ([gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATTCTCCTCCAAAT, downstream forward: _UP4_TAACAAAAAAAGCTCCCTTT
  • BKK37040 ([gene|1E602BCB2A416CDBF2B5007765EC9628123FE979|ywkB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATATTCTCCTCCAAAT, downstream forward: _UP4_TAACAAAAAAAGCTCCCTTT
  • References

  • 12949160,21815947