SubtiBank SubtiBank
yyzO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yyzO

unknown, putative pseudogene
locus
BSU_40359
pI
0.00
mw
0.00 kDa
protein length
gene length
189 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,147,114 4,147,302

    The protein

    Structure

  • [PDB|3SL2] (domain of [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK], 45% identity)
  • Biological materials

    Mutant

  • BKE40359 ([gene|1E81C0C23C16DC0E96FE8436BE2EEC20E1160EC7|yyzO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40359 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAAAACGTCACTTCT, downstream forward: _UP4_CTGATCAGGCTTCCTGCTCC
  • BKK40359 ([gene|1E81C0C23C16DC0E96FE8436BE2EEC20E1160EC7|yyzO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40359 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAAAACGTCACTTCT, downstream forward: _UP4_CTGATCAGGCTTCCTGCTCC