SubtiBank SubtiBank
resD
The papers of the month are back! Check them out! Link here

resD

two-component response regulator ([SW|OmpR family]), regulation of aerobic and anaerobic respiration, activates expression of target genes in response to oxygen limitation
locus
BSU23120
pI
5.63
mw
27.34 kDa
protein length
240 aa Sequence Blast
gene length
720 bp Sequence Blast
function
regulation of aerobic and anaerobic respiration
product
two-component response regulator ([SW|OmpR family])
essential
no
synonyms
ypxD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    2,417,181 → 2,417,903

    Phenotypes of a mutant

  • a ''resD'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
  • The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Modification

  • phosphorylated by [protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|ResE] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|2OQR] (RegX3 from Mycobacterium tuberculosis, 37% identity) [pubmed|17942407]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000009 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]-[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|8631715]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
  • view in new tab

    genes
    [gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|8631715]

    regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE23120 (Δ[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCCTGCTTTC, downstream forward: _UP4_TATAAATTTGAGGTCGGCGC
  • BKK23120 (Δ[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCCTGCTTTC, downstream forward: _UP4_TATAAATTTGAGGTCGGCGC
  • Labs working on this gene/protein

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [http://www.uic.edu/depts/bios/faculty/hulett/hulettm.shtml Homepage]
  • References

    Reviews

  • 23046954
  • Original publications

  • 8682783,15576792,16885274,16885456,11325953,10094672,17322317,8631715,9988472,10972837,10972836,9352926,16825793,8631715,11222591,9988472,21091510,22287527,21710567,24214949,27791134,26296725,28439033,17942407,28899391