SubtiBank SubtiBank
ywdD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywdD

unknown
locus
BSU_38000
pI
9.97
mw
18.30 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-54d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,899,853 3,900,488

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • BKE38000 ([gene|1E915C58089172CE4658211DB32B11092C447A65|ywdD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTTCGGATACATATG, downstream forward: _UP4_TGATTTTTTAGGTATATACA
  • BKK38000 ([gene|1E915C58089172CE4658211DB32B11092C447A65|ywdD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGATTTCGGATACATATG, downstream forward: _UP4_TGATTTTTTAGGTATATACA