SubtiBank SubtiBank
ybfP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybfP

similar to transcription factor ([SW|AraC family])
locus
BSU_02320
pI
6.28
mw
34.06 kDa
protein length
295 aa Sequence Blast
gene length
888 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    251,427 252,314

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [SW|HTH araC/xylS-type domain] (aa 8-106) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]-[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]
    description
    [Pubmed|12207695]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]
    description
    [Pubmed|20817675]

    regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • BKE02320 ([gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCACGCTCCAATCTCC, downstream forward: _UP4_TAGTTTTCAGACAACTACTT
  • BKK02320 ([gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCACGCTCCAATCTCC, downstream forward: _UP4_TAGTTTTCAGACAACTACTT
  • References

  • 12207695,20817675,23504016