SubtiBank SubtiBank
ybfP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybfP

similar to transcription factor ([SW|AraC family])
locus
BSU_02320
pI
6.28
mw
34.06 kDa
protein length
295 aa Sequence Blast
gene length
888 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    251,427 252,314

    The protein

    Protein family

  • [SW|AraC family]
  • Expression and Regulation

    Operons

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]-[gene|E06787B6AAD11070751938822F75359CE6EF299C|ybfQ]
    description
    [Pubmed|12207695]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696,20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    genes
    [gene|BA60CF44ECA4937FA5C1720B10E7FDABA9AB4664|ybfO]-[gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]
    description
    [Pubmed|20817675]

    regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • BKE02320 ([gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCACGCTCCAATCTCC, downstream forward: _UP4_TAGTTTTCAGACAACTACTT
  • BKK02320 ([gene|1EE8BF589ECDFD5194C86E02A627CCF81899B904|ybfP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCACGCTCCAATCTCC, downstream forward: _UP4_TAGTTTTCAGACAACTACTT
  • References

  • 12207695,20817675,23504016