SubtiBank SubtiBank
ganR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ganR

transcriptional repressor of the galactan utilization operon
locus
BSU_34170
pI
5.40
mw
37.31 kDa
protein length
330 aa Sequence Blast
gene length
993 bp Sequence Blast
function
regulation of galactan utilization
product
transcriptional repressor ([SW|LacI family])
essential
no
synonyms
yvfJ,ganR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.24|Utilization of galactan]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,508,659 3,509,651

    The protein

    Protein family

  • [SW|LacI family]
  • Effectors of protein activity

  • released from DNA upon binding of galactobiose [pubmed|22383849,27501980]
  • Structure

  • [PDB|2HSG] (B. megaterium [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA], 25% identity) [pubmed|17500051]
  • Expression and Regulation

    Operons

    genes
    [gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [pubmed|22383849], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843]
  • view in new tab

    Biological materials

    Mutant

  • GP815 ([gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::spc) available in [SW|Jörg Stülke]'s lab
  • BKE34170 ([gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTATCTGCCTCCATTA, downstream forward: _UP4_TAAGGATGACTTAGGACACT
  • BKK34170 ([gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTATCTGCCTCCATTA, downstream forward: _UP4_TAAGGATGACTTAGGACACT
  • References

  • 2104611,9287030,27501980,22383849,17500051