SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional repressor of the galactan utilization operon
37.31 kDa
protein length
330 aa Sequence Blast
gene length
990 bp Sequence Blast
regulation of galactan utilization
transcriptional repressor ([SW|LacI family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of galactan]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,508,659 → 3,509,651

    The protein

    Protein family

  • [SW|LacI family]
  • Effectors of protein activity

  • released from DNA upon binding of galactobiose [pubmed|22383849,27501980]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [pubmed|22383849], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843]
  • view in new tab

    Biological materials


  • GP815 (Δ[gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::spc) available in the [SW|Jörg Stülke]'s lab
  • BKE34170 (Δ[gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTATCTGCCTCCATTA, downstream forward: _UP4_TAAGGATGACTTAGGACACT
  • BKK34170 (Δ[gene|1F787F70C87DEB221709579122D63C2322A84E56|ganR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTATCTGCCTCCATTA, downstream forward: _UP4_TAAGGATGACTTAGGACACT
  • References

  • 2104611,9287030,27501980,22383849