SubtiBank SubtiBank
abnA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

abnA

endo-1,5-alpha-L-arabinosidase
locus
BSU_28810
pI
8.62
mw
34.13 kDa
protein length
323 aa Sequence Blast
gene length
972 bp Sequence Blast
function
arabinan degradation
product
endo-1,5-alpha-L-arabinosidase
essential
no
ec
3.2.1.99
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.6|Utilization of arabinan/ arabinose/ arabitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,949,053 2,950,024

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (1->5)-alpha-arabinofuranosidic linkages in (1->5)-arabinans (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 43 family] (according to UniProt)
  • Structure

  • [PDB|1UV4]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|1F85A1324B8694FB3731376AFE6FFB162C096586|abnA]
    description
    [Pubmed|14973026]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14973026], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|14973026], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed in the absence of arabinose ([protein|search|AraR]) [Pubmed|14973026]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE28810 ([gene|1F85A1324B8694FB3731376AFE6FFB162C096586|abnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCAACCTCCTT, downstream forward: _UP4_TGAATTAAAAAGCCGGGCTC
  • BKK28810 ([gene|1F85A1324B8694FB3731376AFE6FFB162C096586|abnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTGTTCAACCTCCTT, downstream forward: _UP4_TGAATTAAAAAGCCGGGCTC
  • References

  • 15556708,14973026,12884008,22900538,14973026,18957862