SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


acyl-CoA carboxylase, biotinylated subunit
8.00 kDa
protein length
gene length
222 bp Sequence Blast
mother cell metabolism, leucine utilization
acyl-CoA carboxylase subunit

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,952,945 1,953,166

    The protein


  • Biotinyl-binding domain (aa 2-69) (according to UniProt)
  • [SW|Cofactors]

  • biotin [Pubmed|24816803]
  • Structure

  • [PDB|1Z6H] [Pubmed|16699181]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials


  • BKE18239 ([gene|1FBF1512C28BCE04E7D51247D94DC88C72FBFF07|yngHB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACCGTCATGACAACTGCCT, downstream forward: _UP4_ACTCAATAATTTGGAGGAAG
  • BKK18239 ([gene|1FBF1512C28BCE04E7D51247D94DC88C72FBFF07|yngHB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACCGTCATGACAACTGCCT, downstream forward: _UP4_ACTCAATAATTTGGAGGAAG
  • References

  • 15699190,12662922,19935659,24816803,16699181