SubtiBank SubtiBank
lpdV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lpdV

2-oxoisovalerate dehydrogenase (E3 subunit, dihydrolipoamide dehydrogenase)
locus
BSU_24060
pI
4.89
mw
48.51 kDa
protein length
474 aa Sequence Blast
gene length
1425 bp Sequence Blast
function
utilization of branched-chain keto acids
product
2-oxoisovalerate dehydrogenase (E3 subunit, dihydrolipoamide dehydrogenase)
essential
no
ec
1.8.1.4
synonyms
yqiV,bkd

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • Gene

    Coordinates
    2,500,104 2,501,528

    The protein

    Catalyzed reaction/ biological activity

  • (R)-N6-dihydrolipoyl-L-lysyl-[protein] + NAD+ --> (R)-N6-lipoyl-L-lysyl-[protein] + H+ + NADH (according to UniProt)
  • Protein family

  • class-I pyridine nucleotide-disulfide oxidoreductase family (with [protein|E9BBAE86DF3E536A987179CC394B472F6F710498|PdhD] and [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|AcoL], according to UniProt)
  • Paralogous protein(s)

  • [protein|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|AcoL], [protein|E9BBAE86DF3E536A987179CC394B472F6F710498|PdhD]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2YQU] (from ''Thermus thermophilus (hb8 mutant)'', 42% identity, 55% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10094682], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR]: activation, [Pubmed|10094682], in [regulon|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C379 (yqiV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2377 NBRP B. subtilis, Japan]
  • BKE24060 ([gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGACTCACTCCTGTC, downstream forward: _UP4_TAAAAGCATAAAGGAGGGGC
  • BKK24060 ([gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTGACTCACTCCTGTC, downstream forward: _UP4_TAAAAGCATAAAGGAGGGGC
  • References

  • 12427936,15241682,10094682,12823818,28371347