SubtiBank SubtiBank
narI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

narI

nitrate reductase (gamma subunit)
locus
BSU_37250
pI
10.04
mw
25.15 kDa
protein length
223 aa Sequence Blast
gene length
672 bp Sequence Blast
function
nitrate respiration, nitrogen assimilation
product
nitrate reductase (gamma subunit)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.2|Anaerobic respiration]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,823,558 3,824,229

    The protein

    Catalyzed reaction/ biological activity

  • quinol + nitrate --> quinone + H2O + nitrite (according to UniProt)
  • [SW|Cofactors]

  • heme b [Pubmed|11289299]
  • Structure

  • [PDB|1Q16] (the [protein|B992698A12EE9D17DCEF075F82396D5456D35A20|NarG]-[protein|6181C785427277C097B81D67A93213AEAF701FF4|NarH]-[protein|20060F4C1939FB9A10CB279745D75D0A16627EC6|NarI] complex of E. coli, 37% identity) [pubmed|12910261]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B992698A12EE9D17DCEF075F82396D5456D35A20|narG]-[gene|6181C785427277C097B81D67A93213AEAF701FF4|narH]-[gene|5528AD62C1BF608D181C8960C88620B63B1E60A0|narJ]-[gene|20060F4C1939FB9A10CB279745D75D0A16627EC6|narI]
    description
    [Pubmed|8846791,16428414]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8846791,16428414], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|Fnr]) [Pubmed|8846791,16428414]
  • view in new tab

    Biological materials

    Mutant

  • BKE37250 ([gene|20060F4C1939FB9A10CB279745D75D0A16627EC6|narI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATACCCCAGAGGATCTGCC, downstream forward: _UP4_TGAAAATCCCCCTTGCAAGA
  • BKK37250 ([gene|20060F4C1939FB9A10CB279745D75D0A16627EC6|narI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATACCCCAGAGGATCTGCC, downstream forward: _UP4_TGAAAATCCCCCTTGCAAGA
  • References

    Reviews

  • 11289299
  • Original publications

  • 9352926,8846791,16428414,12910261