SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glycine decarboxylase (subunit 2)
54.26 kDa
protein length
488 aa Sequence Blast
gene length
1467 bp Sequence Blast
glycine utilization
glycine decarboxylase (subunit 2)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of threonine/ glycine]
  • Gene

    2,545,410 2,546,876

    The protein

    Catalyzed reaction/ biological activity

  • glycine + H+ + N6-lipoyl-L-lysyl-[glycine-cleavage complex H protein] --> (R)-N6-(S8-aminomethyldihydrolipoyl)-L-lysyl-[glycine-cleavage complex H protein] + CO2 (according to UniProt)
  • Protein family

  • GcvP family (with [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|GcvPA], according to UniProt)
  • [SW|Cofactors]

  • pyridoxal phosphate (according to UniProt)
  • Structure

  • [PDB|1WYT] (the [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|GcvPA]-[protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|GcvPB] complex from Thermus thermophilus, 56% identity) [pubmed|15791207]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|Gly-box|Gly-box]: termination, [pubmed|31992591], in [regulon|Gly-box|Gly-box]
  • regulation

  • induced by glycine [Pubmed|15472076]
  • the [SW|Gly-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-C470 (yqhK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24550 ([gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAAAAATAAGTGCCTGGT, downstream forward: _UP4_TAAATAAAAACAGCTGTCTA
  • BKK24550 ([gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAAAAATAAGTGCCTGGT, downstream forward: _UP4_TAAATAAAAACAGCTGTCTA
  • References

  • 12107147,15472076,28516784,15791207