SubtiBank SubtiBank
gcvPB

gcvPB

glycine decarboxylase (subunit 2)
locus
BSU_24550
pI
5.28
mw
54.26 kDa
protein length
488 aa Sequence Blast
gene length
1467 bp Sequence Blast
function
glycine utilization
product
glycine decarboxylase (subunit 2)
essential
no
ec
1.4.4.2
synonyms
yqhK,gcvP

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • Gene

    Coordinates
    2,545,410 2,546,876

    The protein

    Catalyzed reaction/ biological activity

  • glycine + H+ + N6-lipoyl-L-lysyl-[glycine-cleavage complex H protein] --> (R)-N6-(S8-aminomethyldihydrolipoyl)-L-lysyl-[glycine-cleavage complex H protein] + CO2 (according to UniProt)
  • Protein family

  • GcvP family (with [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|GcvPA], according to UniProt)
  • [SW|Cofactors]

  • pyridoxal phosphate (according to UniProt)
  • Structure

  • [PDB|1WYT] (the [protein|DB0618EBA12013842ED3972165D0276F438D8EC1|GcvPA]-[protein|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|GcvPB] complex from Thermus thermophilus, 56% identity) [pubmed|15791207]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F6F449170276055E6D60D89E9E17A152A82CA166|gcvT]-[gene|DB0618EBA12013842ED3972165D0276F438D8EC1|gcvPA]-[gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]
    description
    [Pubmed|15472076]

    regulatory mechanism

  • [regulon|Gly-box|Gly-box]: termination, in [regulon|Gly-box|Gly-box]
  • regulation

  • induced by glycine [Pubmed|15472076]
  • the [SW|Gly-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C470 (yqhK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2468 NBRP B. subtilis, Japan]
  • BKE24550 ([gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAAAAATAAGTGCCTGGT, downstream forward: _UP4_TAAATAAAAACAGCTGTCTA
  • BKK24550 ([gene|20175DF9FCF07C34A05C572B089C33D1E1FE6DF2|gcvPB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAAAAATAAGTGCCTGGT, downstream forward: _UP4_TAAATAAAAACAGCTGTCTA
  • References

  • 12107147,15472076,28516784,15791207