SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


1-pyrroline-5-carboxylate dehydrogenase
56.32 kDa
protein length
515 aa Sequence Blast
gene length
1548 bp Sequence Blast
proline utilization
1-pyrroline-5-carboxylate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of proline]
  • Gene

    345,479 347,026

    Phenotypes of a mutant

  • no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamate 5-semialdehyde + NAD+ --> 2 H+ + L-glutamate + NADH (according to UniProt)
  • Protein family

  • [SW|aldehyde dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY], [protein|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|GbsA]
  • Structure

  • [PDB|3RJL] (1-pyrroline-5-carboxylate dehydrogenase from ''Bacillus licheniformis'', 90% identity, 97% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR]: activation, [Pubmed|21840319,21964733,22139509], in [regulon|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, displacement of [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR] [Pubmed|21840319], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • overexpressed in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [PubMed|14976255]
  • the [gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP] part of the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • view in new tab

    Biological materials


  • MGNA-B993 (ycgN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03210 ([gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGATAATCTCTC, downstream forward: _UP4_TAAGCGGGACTAAATGGGCA
  • BKK03210 ([gene|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|putC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCATGATAATCTCTC, downstream forward: _UP4_TAAGCGGGACTAAATGGGCA
  • References

  • 12618455,14976255,14651647,21840319,23033921,21964733,22139509