SubtiBank SubtiBank
tcyA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

tcyA

cystine and diaminopimelate [SW|ABC transporter] (binding protein)
locus
BSU_03610
pI
9.12
mw
29.32 kDa
protein length
268 aa Sequence Blast
gene length
807 bp Sequence Blast
function
cystine uptake
product
cystine and diaminopimelate [SW|ABC transporter] (binding protein)
essential
no
synonyms
yckK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    410,656 411,462

    The protein

    Catalyzed reaction/ biological activity

  • uptake of cystine and diaminopimelate [pubmed|29995990]
  • Protein family

  • [SW|bacterial solute-binding protein 3 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|YckB]
  • Structure

  • [PDB|2YLN] (from Neisseria gonorrhoeae, 54% identity) [pubmed|22138345]
  • [SW|Localization]

  • attached to the membrane via [protein|9400DF25487461E3738DDDC72BDDB1589281409D|TcyB] [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]-[gene|9400DF25487461E3738DDDC72BDDB1589281409D|tcyB]-[gene|B453986691E1231A1C565D469A2A60EBFF2F6BD3|tcyC]
    description
    [Pubmed|22383849,15262924]

    regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials

    Mutant

  • BKE03610 ([gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCCCCACTTTTC, downstream forward: _UP4_GAAGATGTTTCTAAATAATC
  • BKK03610 ([gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCCCCACTTTTC, downstream forward: _UP4_GAAGATGTTTCTAAATAATC
  • References

  • 15262924,10092453,7551042,23033921,22138345,29995990