SubtiBank SubtiBank
aimP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

aimP

Viral quorum sensor, Phage SPbeta lysogeny promoter
locus
BSU_20850
pI
6.26
mw
4.08 kDa
protein length
gene length
126 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
AimP,yopL

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,208,855 2,208,980

    The protein

    Catalyzed reaction/ biological activity

  • Proteolytically cleaved in extracellular space to yield hexapeptide (GMPRGA) regulator. Hexapeptide re-enters cells and binds to [protein|CAE7D8E45DA7CDE99D3EA114DF7E368A0A126389|AimR] to promote SPbeta lysogeny. ([Pubmed|31149347])
  • Structure

  • Hexapeptide bound to [protein|CAE7D8E45DA7CDE99D3EA114DF7E368A0A126389|AimR]: [PDB|5Y24] ([Pubmed|30224798]), [PDB|5ZW6] ([Pubmed|30323253]), [PDB|6IM4] ([Pubmed|30421358]), [PDB|6HP5] ([Pubmed|30745087]), [PDB|6JG9] ([Pubmed|31149347])
  • Expression and Regulation

    Operons

    genes
    [gene|20735BFECA52826F0F4D55843EEE7798F414993C|aimP]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: transcription repression [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE20850 ([gene|20735BFECA52826F0F4D55843EEE7798F414993C|aimP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTCACCTCCTTTAA, downstream forward: _UP4_TAAAATCCATTGACACATAA
  • BKK20850 ([gene|20735BFECA52826F0F4D55843EEE7798F414993C|aimP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTCACCTCCTTTAA, downstream forward: _UP4_TAAAATCCATTGACACATAA
  • References

  • 12850135,12850135,20525796,30224798,30323253,30421358,30745087,31149347