SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cardiolipin synthase, major enzyme
55.70 kDa
protein length
482 aa Sequence Blast
gene length
1449 bp Sequence Blast
biosynthesis of phospholipids
cardiolipin synthase, major enzyme

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,762,664 3,764,112

    Phenotypes of a mutant

  • increased conjugation of ICEBs1 [Pubmed|26833415]
  • The protein

    Catalyzed reaction/ biological activity

  • 2 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) --> cardiolipin + glycerol (according to UniProt)
  • Protein family

  • phospholipase D family (with [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE] and [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], according to UniProt)
  • Paralogous protein(s)

  • [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE], [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE]
  • [SW|Domains]

  • 2 PLD phosphodiesterase domains (aa 217-244, aa 395-422) (according to UniProt)
  • [SW|Localization]

  • cell membrane at the septum, this localization depends on two C-terminal helices [Pubmed|26708983,15743965]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE36590 ([gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGTAACCCCGCTCAT, downstream forward: _UP4_TAAGATGCGTAAACCCCCGG
  • BKK36590 ([gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGTAACCCCGCTCAT, downstream forward: _UP4_TAAGATGCGTAAACCCCCGG
  • References

  • 18820022,14973018,16514141,15743965,26708983,26833415,28376879