SubtiBank SubtiBank


dihydroanticapsin 7-dehydrogenase
27.17 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
biosynthesis of the antibiotic bacilysin
dihydroanticapsin 7-dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    3,872,105 3,872,872

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of the C(7)-hydroxyl, penultimate step in bacilysin biosynthesis [Pubmed|23317005]
  • L-dihydroanticapsin + NAD+ --> H+ + L-anticapsin + NADH (according to UniProt)
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3161519994609DA9360ED6E073E4A4C8C6210EFB|YdaD], [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO], [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC], [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|YhxD], [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF], [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF]
  • [protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|YxbG]:
  • [protein|0FD332269D2D6103E57ACE719E39977C68E38F0A|YvrD]:
  • [SW|Cofactors]

  • NAD+ [pubmed|28158843]
  • Structure

  • [PDB|5ITV] [pubmed|28158843]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-B669 (ywfD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37720 ([gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTTTTATCGGTGAGGTTCA, downstream forward: _UP4_CAATAGAGAAGGAGTGTTTT
  • BKK37720 ([gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTTTTATCGGTGAGGTTCA, downstream forward: _UP4_CAATAGAGAAGGAGTGTTTT
  • References

  • 15609023,12372825,21948839,19801406,28158843