SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], part of the [SW|phosphorelay]
47.71 kDa
protein length
429 aa Sequence Blast
gene length
1287 bp Sequence Blast
initiation of [SW|sporulation]
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,230,067 → 3,231,353

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]
  • mainly active in the older, inner regions of a colony (with [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA]) [Pubmed|21097618]
  • senses potassium level in the medium during initiation of [SW|sliding] [Pubmed|26152584]
  • senses changes in respiratory activity [pubmed|23599347]
  • senses nutrient starvation in MM medium to initiate sporulation [pubmed|29314743]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • six transmembrane segments, C-terminal histidine phosphotransferase domain
  • selectivity filter sequence of potassium channels that is required for [SW|sliding] but not for [SW|sporulation] [Pubmed|26152584]
  • [SW|Histidine kinase domain] (aa 218-426) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • activity is triggered at low respiratory activity, this depends on a functional interaction with the respiration apparatus [Pubmed|23599347]
  • Structure

  • [PDB|3D36] (from G. stearothermophilus, complex with [protein|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|Sda]) [pubmed|19101565]
  • [SW|Localization]

  • cell membrane (integral membrane protein) [Pubmed|23599347]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8497199], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [regulon|stringent response|stringent response]: positive regulation, [Pubmed|23378509], in [regulon|stringent response|stringent response]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [pubmed|29321771], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • induced upon addition of decoyinine (positive [SW|stringent response]) [Pubmed|23378509]
  • view in new tab

    additional information

  • [gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB] expression is increased in a [gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho] mutant due to increased transcriptional readthrough [pubmed|28723971]
  • Biological materials


  • JH19980 (''kinB''::''tet'') [Pubmed|9334321]
  • BKE31450 (Δ[gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC, downstream forward: _UP4_TAGCAAATCGATTGGAACTT
  • BKK31450 (Δ[gene|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|kinB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTGTGAAATCCTTTC, downstream forward: _UP4_TAGCAAATCGATTGGAACTT
  • References

  • 26152584,8576055,16166384,9299348,8497199,10094672,9426145,11069677,12618455,11902725,12618455,7592498,21097618,19101565,23378509,23599347,26152584,28723971,29314743,29321771,19101565