SubtiBank SubtiBank
yusE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yusE

similar to thioredoxin
locus
BSU_32770
pI
5.70
mw
12.11 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    3,365,069 3,365,389

    Phenotypes of a mutant

  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • The protein

    [SW|Domains]

  • [SW|Thioredoxin domain] (aa 1-101) (according to UniProt)
  • Structure

  • [PDB|2WZ9] (human thioredoxin domain, 26% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|2122B0B9C3CB9488285ABDAEA451B45CD310268C|yusE]-[gene|8907351A05E7A2717AD6E743F0240FD94723425B|yusD]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yusED.html DBTBS]) null

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B590 (yusE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1589 NBRP B. subtilis, Japan]
  • BKE32770 ([gene|2122B0B9C3CB9488285ABDAEA451B45CD310268C|yusE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTGTTCTTGGAGTTCTT, downstream forward: _UP4_TGACATATTTCTCAGCATAT
  • BKK32770 ([gene|2122B0B9C3CB9488285ABDAEA451B45CD310268C|yusE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCGTGTTCTTGGAGTTCTT, downstream forward: _UP4_TGACATATTTCTCAGCATAT
  • References

  • 14651647,25875741