SubtiBank SubtiBank
yesX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yesX

rhamnogalacturonanlyase, degrades oligo- to disaccharides
locus
BSU_07060
pI
5.22
mw
67.51 kDa
protein length
612 aa Sequence Blast
gene length
1839 bp Sequence Blast
function
utilization of rhamnogalacturonan
product
rhamnogalacturonan lyase, degrades oligo- to disaccharides
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • Gene

    Coordinates
    772,142 773,980

    The protein

    Catalyzed reaction/ biological activity

  • Exotype eliminative cleavage of alpha-L-rhamnopyranosyl-(1->4)-alpha-D-galactopyranosyluronic acid bonds of rhamnogalacturonan I oligosaccharides containing alpha-L-rhamnopyranose at the reducing end and 4-deoxy-4,5-unsaturated D-galactopyranosyluronic acid at the non-reducing end. The products are the disaccharide 2-O-(4-deoxy-beta-L-threo-hex-4-enopyranuronosyl)-alpha-L-rhamnopyranose and the shortened rhamnogalacturonan oligosaccharide containing one 4-deoxy-4,5-unsaturated D-galactopyranosyluronic acid at the non-reducing end (according to UniProt)
  • Protein family

  • polysaccharide lyase 11 family (with [protein|65704140C3B95619D6C0962CB40452D373E2740F|YesW], according to UniProt)
  • Paralogous protein(s)

  • [protein|65704140C3B95619D6C0962CB40452D373E2740F|YesW]
  • Structure

  • [PDB|2ZUY]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]-[gene|585CA3154C0405697C4707E5B1D9359963999C54|yesT]-[gene|E4C4AEBA8DAEF7DA1B49432213B2B3EA2AF6B34B|yesU]-[gene|8FE909876A7A21B436CA0CFB90ED190BAD17C8E1|yesV]-[gene|65704140C3B95619D6C0962CB40452D373E2740F|yesW]-[gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]-[gene|578B79EB64B804FCAACA73AB22458481371A815C|yesY]-[gene|3226901F1D7C1F21296AB974CAE3656C18BE8F69|yesZ]
    description
    [Pubmed|19651770]

    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B261 (yesX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1260 NBRP B. subtilis, Japan]
  • BKE07060 ([gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATGGGAACGGGCTG, downstream forward: _UP4_TAGGAGGACTAAGGGATAAG
  • BKK07060 ([gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATGGGAACGGGCTG, downstream forward: _UP4_TAGGAGGACTAAGGGATAAG
  • References

  • 19651770,17449691,19193638