SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


required for [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin maturation
18.51 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
maturation of the [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC] toxin

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • Gene

    3,464,289 3,464,765

    The protein

    Paralogous protein(s)

  • [protein|FBA412B070CE4FFE554F2657E0F745EF5C853B8A|YitP]
  • [SW|Localization]

  • cytoplasm [Pubmed|23687264]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|15687200,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • additional information

  • the amount of the mRNA is substantially decreased upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • MGNA-A453 (yvaW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33750 ([gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAGTAATAATTCCCT, downstream forward: _UP4_GTATGAAGATATTAAATAGT
  • BKK33750 ([gene|219092C574A13B81CD312AEB55BAE48A3C541FB7|sdpA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACAGTAATAATTCCCT, downstream forward: _UP4_GTATGAAGATATTAAATAGT
  • References


  • 20955377
  • Original Publications

  • 12817086,14651647,15687200,15743949,15687200,17720793,12850135,23687264,21815947