SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


alanine permease
50.16 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
uptake of D- and L-alanine
alanine permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/acquisition of L- and D-alanine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,124,250 3,125,641

    Phenotypes of a mutant

  • a [gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA] [gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr] double mutant is not viable due to the inability to acquire D-alanine [ reference]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of D- and L-alanine [ reference]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP]
  • Structure

  • [PDB|6F34] (from Geobacillus kaustophilus, 21% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • constitutive
  • view in new tab

    Biological materials


  • MGNA-A126 (ytnA::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1885 (Δ[gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::''spc'') available in [SW|Jörg Stülke]'s lab
  • BKE30530 ([gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA, downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
  • BKK30530 ([gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA, downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
  • Expression vector

  • pGP2280: expression of ''ytnA'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2276 (in [SW|pAC5]) (GP2963), available in [SW|Jörg Stülke]'s lab
  • References

  • 10498721,29416041