SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


nucleotide-sugar-dependent glycosyltransferase
30.03 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
spore crust polysaccharide synthesis
nucleotide-sugar-dependent glycosyltransferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,892,351 3,893,121

    Phenotypes of a mutant

  • reduced [SW|germination] efficiency [Pubmed|25239894]
  • less hydrophobic spore surface [pubmed|32817102]
  • The protein

    Protein family

  • [SW|glycosyltransferase 2 family] [Pubmed|10350455]
  • Paralogous protein(s)

  • [protein|9EDE093896E8535962903D7A202D69C1BC402C09|CgeD]: the N-terminal 220 aa of [protein|9EDE093896E8535962903D7A202D69C1BC402C09|CgeD] and [protein|219B0AAFB4ABB7E97A906553B73423F712505E27|SpsA]: 45.5% identity
  • Structure

  • [PDB|1QGS] (complex with UDP) [Pubmed|10350455]
  • [PDB|1H7Q] [Pubmed|11733986]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • BKE37910 ([gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTACACCTCCTTCT, downstream forward: _UP4_AAAAAGCTTGGAATGGGGTG
  • BKK37910 ([gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTACACCTCCTTCT, downstream forward: _UP4_AAAAAGCTTGGAATGGGGTG
  • References

  • 9353933,15383836,11733986,10350455,25239894,26577401,32817102