SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|YndF] germinant receptor of unknown specificity
44.66 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
[category|SW 4.2.4|Germination]
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|YndF] germinant receptor

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,910,167 1,911,381

    The protein

    Protein family

  • [SW|GerABKC lipoprotein family] (according to UniProt)
  • Structure

  • [PDB|3N54] ([protein|93D4D6864686E6E559E6CEFA69BAC77EEFAA1BE3|GerBC], 29% identity) [pubmed|20654628]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials


  • MGNA-A024 (yndF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17770 ([gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAGGCAATTGACGTT, downstream forward: _UP4_TAATGAATCCCAAGGAAGAG
  • BKK17770 ([gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCAGGCAATTGACGTT, downstream forward: _UP4_TAATGAATCCCAAGGAAGAG
  • References

  • 15699190,16497325,10762253,20654628