SubtiBank SubtiBank
yisU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisU

similiar to arginine export protein
locus
BSU_10870
pI
8.53
mw
23.92 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,166,008 1,166,670

    The protein

    Protein family

  • LysE/ArgO transporter (TC 2.A.75) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-B192 (yisU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1191 NBRP B. subtilis, Japan]
  • BKE10870 ([gene|221ABA4B180F5EE2F95E6C3D010977F4F60BE240|yisU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAGTCTCCAGCCATT, downstream forward: _UP4_TGAAGGAGAAACAGATGAAA
  • BKK10870 ([gene|221ABA4B180F5EE2F95E6C3D010977F4F60BE240|yisU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAAAGTCTCCAGCCATT, downstream forward: _UP4_TGAAGGAGAAACAGATGAAA