SubtiBank SubtiBank
mmgA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mmgA

degradative acetoacetyl-CoA thiolase
locus
BSU_24170
pI
5.90
mw
41.02 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
mother cell metabolism, leucine utilization
product
degradative acetoacetyl-CoA thiolase
essential
no
ec
2.3.1.9
synonyms
yqiL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,512,861 2,514,042

    The protein

    Catalyzed reaction/ biological activity

  • 2 acetyl-CoA --> CoA + acetoacetyl-CoA [Pubmed|19935659]
  • Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|YhfS], [protein|07498A0A3CB598A6E388540124A4F56E781C86FA|FadA]
  • Structure

  • [PDB|3SS6] (the protein of ''B. anthracis'', 44% identity, 73% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
    description
    [Pubmed|8759838]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • BKE24170 ([gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTCACCTCATTCAG, downstream forward: _UP4_TAAAACATGATGAAAAAGGG
  • BKK24170 ([gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTTCACCTCATTCAG, downstream forward: _UP4_TAAAACATGATGAAAAAGGG
  • References

  • 18246303,8759838,15699190,19935659,23840410