SubtiBank SubtiBank
yqhG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqhG

unknown
locus
BSU_24590
pI
5.98
mw
30.68 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,551,469 2,552,263

    Expression and Regulation

    Operons

    genes
    [gene|565D91F3E0357C5B16CC342FCDA7EFD4B910829C|yqhH]-[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C459 (yqhG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2457 NBRP B. subtilis, Japan]
  • GP1663 (''[gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]-[gene|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI]-[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]''), available in [SW|Jörg Stülke]'s lab
  • BKE24590 ([gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAATAAAACCTCCTTAC, downstream forward: _UP4_TAACTTTTTTACCATTCGAC
  • BKK24590 ([gene|22BEB39F735DAAF71F1B382CD453A9C2D4CC9FA4|yqhG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTAATAAAACCTCCTTAC, downstream forward: _UP4_TAACTTTTTTACCATTCGAC
  • References

  • 16497325