SubtiBank SubtiBank
dynA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

dynA

dynamin-like protein, mediates membrane fusion
locus
BSU_22030
pI
5.72
mw
137.16 kDa
protein length
1193 aa Sequence Blast
gene length
3582 bp Sequence Blast
function
fusion of membranes
product
dynamin-like protein
essential
no
synonyms
ypbR

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.7|Membrane dynamics]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,312,529 2,316,110

    Phenotypes of a mutant

  • sensitive to membrane stress-inducing antibiotics [Pubmed|26530236]
  • The protein

    Catalyzed reaction/ biological activity

  • mediates nucleotide independent membrane fusion ''in vitro'' [Pubmed|21205012]
  • [SW|Domains]

  • two separate dynamin-like subunits and GTPase domains [Pubmed|21205012]
  • [SW|Cofactors]

  • Mg(2 ) [Pubmed|21205012]
  • [SW|Localization]

  • associated to the membrane [Pubmed|21205012]
  • membrane, forms foci at the site of septation [Pubmed|23060960]
  • colocalizes with [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] [Pubmed|23249255]
  • highly dynamic membrane-associated protein; upon membrane damage, DynA localizes into large and static assemblies [Pubmed|26530236]
  • Expression and Regulation

    Operons

    genes
    [gene|22F930B371A833BAEA84B32FADBB2BBA0B91A53B|dynA]-[gene|9899D0CC5FF530A48532A653075494686796564D|ypbS]-[gene|BD8D1EBA85928C4ECA4FF50556FC7C59F9BC0E9D|ypzF]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8396117], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A877 (ypbR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/877 NBRP B. subtilis, Japan]
  • BKE22030 ([gene|22F930B371A833BAEA84B32FADBB2BBA0B91A53B|dynA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCTGAACCCCTTTG, downstream forward: _UP4_TAAAATTCAGTTGGCTTGTA
  • BKK22030 ([gene|22F930B371A833BAEA84B32FADBB2BBA0B91A53B|dynA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCTGAACCCCTTTG, downstream forward: _UP4_TAAAATTCAGTTGGCTTGTA
  • References

    Reviews

  • 23109540,20970992,21599493,15040446
  • Original publications

  • 8396117,21205012,20525796,23060960,23249255,26530236,31361971