SubtiBank SubtiBank
queA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

queA

S-adenosylmethionine tRNA ribosyltransferase
locus
BSU_27720
pI
5.05
mw
38.35 kDa
protein length
342 aa Sequence Blast
gene length
1029 bp Sequence Blast
function
tRNA modification
product
S-adenosylmethionine tRNA ribosyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,833,899 2,834,927

    The protein

    Catalyzed reaction/ biological activity

  • 7-aminomethyl-7-carbaguanosine34 in tRNA + S-adenosyl-L-methionine --> adenine + epoxyqueuosine34 in tRNA + H+ + L-methionine (according to UniProt)
  • Protein family

  • queA family (single member, according to UniProt)
  • Structure

  • [PDB|1YY3] [Pubmed|17083917]
  • Expression and Regulation

    Operons

    genes
    [gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]-[gene|6CDF1836F5B613A6718308A4A27D713193EA197B|yrzS]-[gene|23174B2A19DEDF2F20858A005D0681D36E15E6E3|queA]-[gene|0383C8214ADE2FF70CFDB953A65648B37A9D3216|tgt]-[gene|D15B74263167DAD3FA9B7384B5AA4897EAD498F2|yrbF]
    description
    [pubmed|22383849]

    regulation

  • the mRNA is processed between [gene|0383C8214ADE2FF70CFDB953A65648B37A9D3216|tgt] and [gene|D15B74263167DAD3FA9B7384B5AA4897EAD498F2|yrbF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE27720 ([gene|23174B2A19DEDF2F20858A005D0681D36E15E6E3|queA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTTCACCTTTAT, downstream forward: _UP4_TAATTTGAGAACAGGAGGCC
  • BKK27720 ([gene|23174B2A19DEDF2F20858A005D0681D36E15E6E3|queA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTTCACCTTTAT, downstream forward: _UP4_TAATTTGAGAACAGGAGGCC
  • References

  • 10739928,17083917