SubtiBank SubtiBank
yszA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yszA

unknown
locus
BSU_28099
pI
10.00
mw
7.00 kDa
protein length
gene length
193 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Biological materials

    Mutant

  • BKE28099 ([gene|23217CBC6DE637FD18FF32167E7AC188BF4A32F2|yszA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28099 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGTGCATCCTCCTCTAC, downstream forward: _UP4_ATATAAACAAACAAGTCCGC
  • BKK28099 ([gene|23217CBC6DE637FD18FF32167E7AC188BF4A32F2|yszA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28099 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGGTGCATCCTCCTCTAC, downstream forward: _UP4_ATATAAACAAACAAGTCCGC
  • References

  • 27766092