SubtiBank SubtiBank
lmrB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lmrB

lincomycin-resistance protein (multidrug resistance pump)
locus
BSU_02670
pI
9.70
mw
51.54 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
function
resistance to lincomycin
product
lincomycin-resistance protein
essential
no
synonyms
yccA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    288,653 290,092

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|EmrB family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|93159DC7D5C42CFA54F66F232D73F38957243AB7|YhcA], [protein|188742B9A0C95344D32A4C23B9C971660572CF7D|YcnB]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|52D560AA02F0849CB24460A496021560063B2E12|lmrA]-[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]
    description
    [Pubmed|15317768]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12499232], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|LmrA])[Pubmed|17483215]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • GP1701 (''[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP1703 (''[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]''::''aphA3'' ''[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE02670 ([gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTCTCTATCAAC, downstream forward: _UP4_TAATATGAAAAGCCCCTGAC
  • BKK02670 ([gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTCTCTATCAAC, downstream forward: _UP4_TAATATGAAAAGCCCCTGAC
  • References

  • 15317768,17483215,12499232,21815947