SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


lincomycin-resistance protein (multidrug resistance pump)
51.54 kDa
protein length
479 aa Sequence Blast
gene length
1440 bp Sequence Blast
resistance to lincomycin
lincomycin-resistance protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    288,653 290,092

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|EmrB family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|93159DC7D5C42CFA54F66F232D73F38957243AB7|YhcA], [protein|188742B9A0C95344D32A4C23B9C971660572CF7D|YcnB]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12499232], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52D560AA02F0849CB24460A496021560063B2E12|LmrA]: repression, [Pubmed|15317768], in [regulon|52D560AA02F0849CB24460A496021560063B2E12|LmrA regulon]
  • regulation

  • induced by flavonoids such as quercetin ([protein|search|LmrA])[Pubmed|17483215]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • GP1701 (''[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP1703 (''[gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]''::''aphA3'' ''[gene|188742B9A0C95344D32A4C23B9C971660572CF7D|ycnB]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE02670 ([gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTCTCTATCAAC, downstream forward: _UP4_TAATATGAAAAGCCCCTGAC
  • BKK02670 ([gene|23483430AE0381406EF2349A18CFAE1F14F9B180|lmrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCCTCTCTATCAAC, downstream forward: _UP4_TAATATGAAAAGCCCCTGAC
  • References

  • 15317768,17483215,12499232,21815947