SubtiBank SubtiBank
jag
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

jag

[protein|D40C202E67A5319A91811DB11356F47A56C97DD2|YidC1]-associated protein, similar to cell elongation regulator
locus
BSU_41030
pI
10.04
mw
23.02 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
function
unknown
product
[protein|D40C202E67A5319A91811DB11356F47A56C97DD2|YidC1]-associated protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • Gene

    Coordinates
    4,213,200 4,213,826

    The protein

    [SW|Domains]

  • [SW|KH domain] (aa 91-140) (according to UniProt)
  • R3H domain (aa 140-208) (according to UniProt)
  • Structure

  • [PDB|3GKU] (from Clostridium symbiosum, 40% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|EB07AECD3849CC0B65126DE27E71B28B3AD106B0|rpmH]-[gene|594F2D36BE71A45303A33AA2A2931F56F0A969ED|rnpA]-[gene|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1]-[gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|D40C202E67A5319A91811DB11356F47A56C97DD2|yidC1]-[gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]
    description
    [Pubmed|1487728]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1487728], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|jag]' [PubMed|20525796]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B878 (jag::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1877 NBRP B. subtilis, Japan]
  • BKE41030 ([gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE41030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCACTTTTTCTTTCCTCC, downstream forward: _UP4_TAGCATAAAACCGAAGTCCG
  • BKK41030 ([gene|23D33E2D7AB1CA02165070DB8238957E3C768E64|jag]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK41030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTCACTTTTTCTTTCCTCC, downstream forward: _UP4_TAGCATAAAACCGAAGTCCG
  • References

  • 1487728,20525796,28710862,26883633