SubtiBank SubtiBank
yitY

yitY

similar to oxidoreductase
locus
BSU_11170
pI
7.32
mw
54.67 kDa
protein length
476 aa Sequence Blast
gene length
1431 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,192,858 1,194,288

    The protein

    Protein family

  • oxygen-dependent FAD-linked oxidoreductase family (with [protein|11499CDC836A40E857B8F5AD746BA2C650DC916B|YgaK] and [protein|C4CC3772CA9FC46D90D2F15AE261106A0BC4453C|CotQ], according to UniProt)
  • [SW|Domains]

  • [SW|FAD-binding PCMH-type domain] (aa 41-210) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4AUT] (from Mycobacterium smegmatis, 24% identity) [pubmed|22956199]
  • Biological materials

    Mutant

  • MGNA-B198 (yitY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1197 NBRP B. subtilis, Japan]
  • BKE11170 ([gene|23F2385D14DDD5C400DC897E0F0FC814ACFC36B8|yitY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGCTCTCCCTGCTGT, downstream forward: _UP4_TAATGGGGAAAAACAAATTA
  • BKK11170 ([gene|23F2385D14DDD5C400DC897E0F0FC814ACFC36B8|yitY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTGCTCTCCCTGCTGT, downstream forward: _UP4_TAATGGGGAAAAACAAATTA
  • References

    Research papers

  • 22956199