SubtiBank SubtiBank
ypqP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypqP

C-terminal part of the split gene spsM (together with [gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]), spore envelope polysaccharide biosynthesis, in B. subtilis 168 the gene is disrupted by the SP-beta prophage
locus
BSU21670
pI
0.00
mw
0.00 kDa
protein length
202 aa Sequence Blast
gene length
606 bp Sequence Blast
function
spore envelope polysaccharide biosynthesis
product
unknown
essential
no
synonyms
spsM

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,286,448 → 2,287,053

    The protein

    Paralogous protein(s)

  • [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|EpsC]:
  • [SW|Domains]

  • SpsM: Polysacc_synt_2 domain (Pfam accession number, PF02719) in the 18–296-aa region [Pubmed|25299644]
  • Structure

  • [PDB|6BWC] (from B. thuringiensis, 39% identity) [pubmed|29266550]
  • Expression and Regulation

    Operons

    genes
    [gene|6CBEACD5C9C88319C4F9BE4C53F5C6534EF9135F|sprA]-[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]

    description

  • [pubmed|22383849]
  • sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A061 (ypqP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/61 NBRP B. subtilis, Japan]
  • BKE21670 (Δ[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATACAGCTTTATCTGTTT, downstream forward: _UP4_TAAAAACAAGCCTGTCTATC
  • BKK21670 (Δ[gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATACAGCTTTATCTGTTT, downstream forward: _UP4_TAAAAACAAGCCTGTCTATC
  • References

  • 25299644,25326298,28535266,29266550