SubtiBank SubtiBank
ydaB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydaB

similar to acyl-CoA synthetase (long-chain-fatty-acid--CoA ligase)
locus
BSU_04170
pI
4.85
mw
51.07 kDa
protein length
503 aa Sequence Blast
gene length
1512 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    469,426 470,937

    The protein

    Protein family

  • [SW|ATP-dependent AMP-binding enzyme family] (according to UniProt)
  • Structure

  • [PDB|3R44] (from Mycobacterium tuberculosis, 33% identity) [pubmed|22560731]
  • Expression and Regulation

    Operons

    genes
    [gene|2436420C7781DCB61B9A939B47747265E23740A5|ydaB]
    description
    [Pubmed|21815947]

    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 2 to 80 min) [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE04170 ([gene|2436420C7781DCB61B9A939B47747265E23740A5|ydaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTCATCTCCTATAT, downstream forward: _UP4_TCATAAAAGAAGAAGCCCGT
  • BKK04170 ([gene|2436420C7781DCB61B9A939B47747265E23740A5|ydaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTCATCTCCTATAT, downstream forward: _UP4_TCATAAAAGAAGAAGCCCGT
  • References

  • 1460045,21815947,22560731