SubtiBank SubtiBank
xylA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

xylA

xylose isomerase
locus
BSU_17600
pI
5.64
mw
50.09 kDa
protein length
445 aa Sequence Blast
gene length
1338 bp Sequence Blast
function
utilization of xylan and xylose
product
xylose isomerase
essential
no
ec
5.3.1.5
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.5|Utilization of xylan/ xylose]
  • Gene

    Coordinates
    1,891,908 1,893,245

    The protein

    Catalyzed reaction/ biological activity

  • D-xylose --> D-xylulose
  • Protein family

  • xylose isomerase family (according to Swiss-Prot)
  • Structure

  • [PDB|1A0D] (Geobacillus stearothermophilus)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]-[gene|F417A5B46CC7FC69DC8606A46D1AD5E41FA35B13|xylB]
    description
    [Pubmed|1921970]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2454911], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8132469], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|AF4395D134485290F4AA307B48494FED39E52CD7|XylR]: repression, [Pubmed|2454911], in [regulon|AF4395D134485290F4AA307B48494FED39E52CD7|XylR regulon]
  • regulation

  • carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8132469]
  • view in new tab

    Biological materials

    Mutant

  • GP1151 (del aphA3) available in [SW|Jörg Stülke]'s lab
  • 1A719 (no resistance), [Pubmed|1719948], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A719&Search=1A719 BGSC]
  • BKE17600 ([gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATTTCCCCCTTAAA, downstream forward: _UP4_TAACAGGATAAGCTCCAGAT
  • BKK17600 ([gene|24829427B4518FE67038F194B54D4AAFAC64EF19|xylA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATTTCCCCCTTAAA, downstream forward: _UP4_TAACAGGATAAGCTCCAGAT
  • References

  • 7966270,1921970,8132469,2454911,1588910,22900538