SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp]-5 aminopentanone reductase
25.43 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
modification of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp]
[protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp]-5 aminopentanone reductase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation factor modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • Gene

    1,759,655 1,760,383

    Phenotypes of a mutant

  • defective in [category|SW 4.1.4|Swarming] motility [pubmed|28787546], this can be suppressed by mutations affecting earlier steps in [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] modification ([gene|8BB8EECA8ECFA1CC6D46E81250905DBC6D2C503E|gsaB], [gene|EEF3E572ED2F23581EB9B48D16B3112B886F7975|yaaO], [gene|62718BBECEB18244B5CC877509679F5F9A0C50CD|yfkA], [gene|14EFA3BF4E5DD5368EF02B0733300CEF7A4E0DC7|ynbB], [gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]) [pubmed|29615499]
  • The protein

    Catalyzed reaction/ biological activity

  • reduction of [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp]-5 aminopentanone to [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp]-5 aminopentanol [pubmed|28787546]
  • Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC], [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF], [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF]
  • [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG]:
  • [protein|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|YjdA]:
  • [SW|Cofactors]

  • NADPH [pubmed|28787546]
  • Structure

  • [PDB|2PNF] (from Aquifex Aeolicus , 36% identity)
  • Biological materials


  • MGNA-B379 (ymfI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16870 ([gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTTCCTTCTTTCC, downstream forward: _UP4_TGATCCGAAAATATTCGGTG
  • BKK16870 ([gene|248F0805272FED9B38ECBB31E2872BC9EC163CE0|ymfI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTCTTTCCTTCTTTCC, downstream forward: _UP4_TGATCCGAAAATATTCGGTG
  • References

    Research papers

  • 28787546,29615499