SubtiBank SubtiBank
ydeC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydeC

similar to transcription factor (AraC family)
locus
BSU_05150
pI
6.87
mw
34.07 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    561,514 562,389

    The protein

    Protein family

  • [SW|AraC family]
  • Expression and Regulation

    Operons

    genes
    [gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]-[gene|CBEB1C62D727CF320E82C3ED636894B50F11E0AE|ydzE]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11532142], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C079 (ydeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2077 NBRP B. subtilis, Japan]
  • BKE05150 ([gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGACTTCACACCTCA, downstream forward: _UP4_TAAAGTTTATTCTATTAATA
  • BKK05150 ([gene|24A86A4846187E6026A2B7645DC4B7C70908942E|ydeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGACTTCACACCTCA, downstream forward: _UP4_TAAAGTTTATTCTATTAATA
  • References

  • 23504016