SubtiBank SubtiBank


electron transfer flavoprotein (beta subunit)
28.37 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
fatty acid degradation
electron transfer flavoprotein (beta subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • Gene

    2,916,378 2,917,151

    The protein

    Protein family

  • ETF beta-subunit/fixA family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1EFP] (from Paracoccus denitrificans, 37% identity) [pubmed|10026281]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21398533], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|21398533], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by long chain acyl-CoA (C14 ... C20) ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • view in new tab



  • induced by long-chain fatty acids ([protein|search|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • 1A855 ( ''etfB''::''cat''), [Pubmed|17085570], available at [ BGSC]
  • BKE28530 (''[gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE28530 ([gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGATTCATGATCATATCCC, downstream forward: _UP4_TAAAACTTGGACATTCAAAG
  • BKK28530 ([gene|251600E5FD52DC0352A123F1224C037577F5A09C|etfB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGATTCATGATCATATCCC, downstream forward: _UP4_TAAAACTTGGACATTCAAAG
  • References

  • 17189250,17919287,17085570,10026281