SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


6.79 kDa
protein length
gene length
177 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,417,719 1,417,895

    Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|30782632], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • BKE13510 ([gene|25902F1B63034DE3780C279D373F0DE746525C10|ykzE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATTACATGCCTCCCTG, downstream forward: _UP4_TAAAAAAGACCTCTTAGGCG
  • BKK13510 ([gene|25902F1B63034DE3780C279D373F0DE746525C10|ykzE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATTACATGCCTCCCTG, downstream forward: _UP4_TAAAAAAGACCTCTTAGGCG
  • References

    Research papers

  • 30782632