SubtiBank SubtiBank
yomL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yomL

unknown protein
locus
BSU_21320
pI
9.36
mw
25.28 kDa
protein length
228 aa Sequence Blast
gene length
688 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • The protein

    Paralogous protein(s)

  • [protein|D04CF5261C840E9A1BC7FFE5B6F492A46EC0971C|YddT]:
  • Biological materials

    Mutant

  • BP118 (yomL::kan), available in [SW|Fabian Commichau]'s lab [Pubmed|24178028]
  • BKE21320 ([gene|25ACC4472A56ABF9F0FCA75CC24579FBC59E4C2F|yomL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAATCCTCCTTGTG, downstream forward: _UP4_TAATTTTAAAATCACTTTGT
  • BKK21320 ([gene|25ACC4472A56ABF9F0FCA75CC24579FBC59E4C2F|yomL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGAAATCCTCCTTGTG, downstream forward: _UP4_TAATTTTAAAATCACTTTGT
  • Expression vectors

  • IPTG inducible expression of Strep-''yomL'' in ''E. coli'': pGP2580 (in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • References

  • 17114254,23420519,24178028