SubtiBank SubtiBank
yhaR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhaR

similar to enoyl CoA hydratase
locus
BSU_09880
pI
6.36
mw
27.47 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,061,491 1,062,258

    The protein

    Protein family

  • [SW|enoyl-CoA hydratase/isomerase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3111ECB66CD3CFF0494AA3DF4D646102CF3B0FA8|FadB]:
  • [protein|D5CCFDE9312909B7E5B98876794569357791C76B|YngF]:
  • Structure

  • [PDB|3P5M] (from ''Mycobacterium avium'', 33% identity) [pubmed|25613812]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|25B45D6A90AD5152FDA71718B14767EA86ECA15B|yhaR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B498 (yhaR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1497 NBRP B. subtilis, Japan]
  • BKE09880 ([gene|25B45D6A90AD5152FDA71718B14767EA86ECA15B|yhaR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAAGCACCTCCATGT, downstream forward: _UP4_TAACAGATCAGCCGGAAAGC
  • BKK09880 ([gene|25B45D6A90AD5152FDA71718B14767EA86ECA15B|yhaR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAAGCACCTCCATGT, downstream forward: _UP4_TAACAGATCAGCCGGAAAGC
  • References

  • 12850135,27766092