SubtiBank SubtiBank
rapA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

rapA

response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P, control of the [SW|phosphorelay]
locus
BSU_12430
pI
4.85
mw
44.81 kDa
protein length
378 aa Sequence Blast
gene length
1137 bp Sequence Blast
function
control of [SW|sporulation] initiation
product
response regulator aspartate phosphatase
essential
no
synonyms
gsiAA,spo0L

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.5|Phosphatases controlling the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.5|Phosphatases controlling the phosphorelay]
  • Gene

    Coordinates
    1,315,869 1,317,005

    The protein

    Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • modular organization comprising an amino terminal alpha-helical domain connected to a domain formed by six [SW|TPR repeat|tetratrichopeptide repeats] [Pubmed|11923303,22267516]
  • Structure

  • [PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF], 42% identity) [pubmed|23526880]
  • Expression and Regulation

    Operons

    genes
    [gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]-[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]
    description
    [Pubmed|1378051]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1378051], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    Biological materials

    Mutant

  • BKE12430 ([gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAATCCCCCCTTTTGA, downstream forward: _UP4_CAAATCCAGAGAGGAGATTG
  • BKK12430 ([gene|25D89EF3C4D57B3E6F9AB0210029651F74356906|rapA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAATCCCCCCTTTTGA, downstream forward: _UP4_CAAATCCAGAGAGGAGATTG
  • References

  • 8643670,8730857,11923303,22267516,14651647,12618455,12107147,19380751,12850135,1378051,16091051,23569278,26582911,27122155,23526880,32132526