SubtiBank SubtiBank
pncA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pncA

nicotinamidase
locus
BSU_31760
pI
5.60
mw
20.38 kDa
protein length
183 aa Sequence Blast
gene length
552 bp Sequence Blast
function
NAD salvage
product
nicotinamidase
essential
no
synonyms
yueJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • Gene

    Coordinates
    3,260,891 3,261,442

    The protein

    Catalyzed reaction/ biological activity

  • deamination of nicotinamide to nicotinic acid [pubmed|30107912]
  • Protein family

  • [SW|Isochorismatase family] (according to UniProt)
  • Structure

  • [PDB|5ZN8]
  • [PDB|6A8L]
  • Expression and Regulation

    Operons

    genes
    [gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]-[gene|7CA7ADDBDDE46B0E6522704FD19C0BCF6FA9E058|pncB]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|17F2619E74A1604E86ED94E1BEE683D49E437A6C|yueH]-[gene|3918D82756A64E86E96A21ACEB34B0CF992D662D|yueI]-[gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]-[gene|7CA7ADDBDDE46B0E6522704FD19C0BCF6FA9E058|pncB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B563 (yueJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1562 NBRP B. subtilis, Japan]
  • BKE31760 ([gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCCTCCCCGCCA, downstream forward: _UP4_GCAGAGTAAGGAAGGGGAAA
  • BKK31760 ([gene|26430DCCEC263E7D03A3BBA4E7D636A250C3208B|pncA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCCGGCCTCCCCGCCA, downstream forward: _UP4_GCAGAGTAAGGAAGGGGAAA
  • References

    Research papers

  • 30107912