SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


inosose isomerase, converts 2KMI to 1-keto-D-chiro-inositol
31.50 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
myo-inositol catabolism
inosose isomerase, converts 2KMI to 1-keto-D-chiro-inositol

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of inositol]
  • Gene

    4,073,974 4,074,810

    The protein

    Catalyzed reaction/ biological activity

  • 2,4,6/3,5-pentahydroxycyclohexanone --> 2,3,5/4,6-pentahydroxycyclohexanone (according to UniProt)
  • scyllo-inosose --> scyllo-inosine (according to UniProt)
  • Protein family

  • IolI family (single member, according to UniProt)
  • Structure

  • [PDB|1L60]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials


  • MGNA-B700 (iolI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39680 ([gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGACTCCCCCATCT, downstream forward: _UP4_TAATGGATAAAGGAGGGGTG
  • BKK39680 ([gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGACTCCCCCATCT, downstream forward: _UP4_TAATGGATAAAGGAGGGGTG
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,9887260,18310071