SubtiBank SubtiBank
yitI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yitI

similar to glyphosate N-acetyltransferase
locus
BSU_11000
pI
9.17
mw
17.47 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
2.3.1.-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,178,218 1,178,682

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 2-146) (according to UniProt)
  • Structure

  • [PDB|2JDC] (from B. licheniformis, 59% identity) [pubmed|17272278]
  • Expression and Regulation

    Operons

    genes
    [gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]-[gene|1A31885756344F8BD2BED4E4526D43D6D5AB85F3|yitH]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B205 (yitI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1204 NBRP B. subtilis, Japan]
  • BKE11000 ([gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTTTTCTATATC, downstream forward: _UP4_TGATCTTATGGACGTAGTAG
  • BKK11000 ([gene|2751630B6472346B19FB20F57F16013D0FACA9F7|yitI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGTTTTTCTATATC, downstream forward: _UP4_TGATCTTATGGACGTAGTAG
  • References

  • 19258532,17272278, 15155947