SubtiBank SubtiBank
ccdA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ccdA

membrane-embedded thiol-disulfide oxidoreductase
locus
BSU_17930
pI
9.67
mw
25.86 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
cytochrome c synthesis
product
thiol-disulfide oxidoreductase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,923,234 1,923,941

    The protein

    Protein family

  • DsbD family (single member, according to UniProt)
  • Structure

  • [PDB|5VKV] (from Thermus thermophilus, 38% identity) [pubmed|29379172]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|27A25671205E9F6475A1EF00C72F9239AA2A767A|ccdA]-[gene|AE823A0A652509787EA032F122E59F3C3645385F|yneI]-[gene|D869177D5B1CE8B72AF89A18F03D8176ADA42664|yneJ]
    description
    [Pubmed|9068642]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10781554], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE17930 ([gene|27A25671205E9F6475A1EF00C72F9239AA2A767A|ccdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCATCCCTTCATG, downstream forward: _UP4_TGACGGTAAATTACTTTCGT
  • BKK17930 ([gene|27A25671205E9F6475A1EF00C72F9239AA2A767A|ccdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCATCCCTTCATG, downstream forward: _UP4_TGACGGTAAATTACTTTCGT
  • References

  • 9226261,10781554,11844773,10844653,9068642,29379172