SubtiBank SubtiBank
ydaP

ydaP

general stress protein, required for survival of ethanol stress, cold stress (4C) and oxidative stress (superoxide/paraquat), putative pyruvate oxidase
locus
BSU_04340
pI
5.22
mw
62.97 kDa
protein length
574 aa Sequence Blast
gene length
1725 bp Sequence Blast
function
unknown
product
putative pyruvate oxidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    488,830 490,554

    Phenotypes of a mutant

  • sensitive to ethanol, cold (4C) and superoxide stress (paraquat)
  • The protein

    Protein family

  • [SW|TPP enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|AlsS], [protein|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|IlvB]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4KGD] (the enzyme from Lactobacillus plantarum, 37% identity, 70% similarity) [Pubmed|23748673]
  • [PDB|1POW] (from ''Lactobacillus Plantarum'', 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C115 (ydaP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2113 NBRP B. subtilis, Japan]
  • GP457 (spc), available in [SW|Jörg Stülke]'s lab
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT, downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
  • BKK04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT, downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
  • References

  • 22582280,10220166,23748673,15805528,22730460,31534226