SubtiBank SubtiBank
ydaP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydaP

general stress protein, required for survival of ethanol stress, cold stress (4C) and oxidative stress (superoxide/paraquat), putative pyruvate oxidase
locus
BSU_04340
pI
5.22
mw
62.97 kDa
protein length
574 aa Sequence Blast
gene length
1725 bp Sequence Blast
function
unknown
product
putative pyruvate oxidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    488,830 490,554

    Phenotypes of a mutant

  • sensitive to ethanol, cold (4C) and superoxide stress (paraquat)
  • The protein

    Protein family

  • [SW|TPP enzyme family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AAA45830B9C5428CADFA5551D33B513E9B1B7C8E|AlsS], [protein|E6EDDB6D1EDA85D73A0B78A656511D38346A625B|IlvB]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4KGD] (the enzyme from Lactobacillus plantarum, 37% identity, 70% similarity) [Pubmed|23748673]
  • [PDB|1POW] (from ''Lactobacillus Plantarum'', 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C115 (ydaP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2113 NBRP B. subtilis, Japan]
  • GP457 (spc), available in [SW|Jörg Stülke]'s lab
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT, downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
  • BKK04340 ([gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGTATCCTCCTTTTT, downstream forward: _UP4_TAAAAAAACAGGGGCCCTAA
  • References

  • 22582280,10220166,23748673,15805528,22730460,31534226